A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(ta00412) primer
Oligo ID:ta00412
Oligo type: Reverse Primer Denegeracy: 1
Target: 11901-11882 Tm: 72 C at salt 1000.0mMLength: 20
Sequence: TGTTGCGAAAGGACCAACAG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: ta0041 Publication date: 12/02
PMID: 12435688 GI: 9626649 Taxonomy ID:144353
Virus Name: Bovine viral diarrhea virus, BVDV Product size (PCR):
bp
MgCl2:
mM
dNTPs:
mM
Type: Q-RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase:
Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.