A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: PCR Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:MP03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0308 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0309 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0310 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0311 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0312 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0313 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0314 Publication date: 12/99
PMID: 10598089 GI: 6572136 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].



Oligonucleotide information
Reverse(P1) primer
Oligo ID:mp03080
Oligo type: Denegeracy: 1
Target: 3551-3531 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Experimental condition used for the oligonucleotide

Common Data ID: MP0315 Publication date: 12/99
PMID: 10598089 GI: 576561 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].

Total 64 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.