A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
(10002547) primer
Oligo ID:YS00122547
Oligo type: Denegeracy: 1
Target: - Tm: 93.43C at salt 1000.0 mMLength: 70
Sequence: GTGATGGACGACTTGGGCCAAAACCCAGACGGCAAAGACTTCAAGTACTTTGCCCAAATGGTATCCACCA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: YS0012 Publication date: 11/17/2003
PMID: 14624234 GI: 21426907 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Hybridization
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.