A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(VW00241) primer
Oligo ID:VW00240
Oligo type: PCR Denegeracy: 1
Target: 741-760 Tm: 72 C at salt 1000.0mMLength: 20
Sequence: TTACCACACCCCTCAGTACA
(1 other experimental conditions)
Note: BRSV specific primer. Derived from [GI:210828].

Experimental condition used for the oligonucleotide

Common Data ID: VW0024 Publication date: 07/93
PMID: 8373845 GI: 210828 Taxonomy ID:150548
Virus Name: Bovine respiratory syncytial virus A51908, BRSV, Human respiratory syncytial virus (subgroup A / strain Long), HRSV Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 15sec>60C 15sec)*35>60C 105sec
Buffer: N/A
Polymerase: N/ACycler: GeneAmp PCR System 9600 (Perkin Elmer)
Note: BRSV specific primer. Derived from [GI:210828].

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.