A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(B1) primer
Oligo ID:VW00032
Oligo type:
Denegeracy: 1
Target: 1420-1496 Tm: 77.2 C at salt 1000.0mMLength: 25
Sequence: CGCCTTGGAAGGTCTTTGTATCTAC
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: VW0003 Publication date: 12/99
PMID: 10598094 GI: 58689 Taxonomy ID:10385
Virus Name: Bovine herpesvirus 4, BHV4 Product size (PCR): 179 bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):94C 15min>(94C 1min>58C 1min>70C 2min)*40>72C 10min
Buffer: 60mM Tris-HCl (pH 8.5), 15mM (NH4)2SO4, 0.2mM dUTP
Polymerase: 0.025U/microLTaq poly (Perkin Elmer/Applied Biosystems)Cycler: Thermocycler 60/2 (bio-med, Theres)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.