A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(COR-2) primer
Oligo ID:UM00211
Oligo type:
Denegeracy: 1
Target: 15628-15603 Tm: 72.6 C at salt 1000.0mMLength: 26
Sequence: AAATGTTTACGCAGGTAAGCGTAAAA
(6 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0021 Publication date: 04/03
PMID: N/A GI: 30523247 Taxonomy ID:227984
Virus Name: SARS coronavirus Product size (PCR): 310 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):N/A
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: Target range from sequence.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.