A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SAR1As) primer
Oligo ID:UM00181
Oligo type: PCR Denegeracy: 1
Target: 15391-15371 Tm: 74.4 C at salt 1000.0mMLength: 21
Sequence: TATAGTGAGCCGCCACACATG
(3 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0018 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 108 bp
MgCl2: 0.42 mM dNTPs: 0.03 mM Type: Nested PCR
Temp (PCR cycle):95C 3min>(95C 10sec>60C 10sec[-1C/cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*20
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.