A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:UM00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0017 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 189 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0002 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 109 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 190 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SA0004 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:um00170
Oligo type: PCR Denegeracy: 1
Target: 18153-18176 Tm: 70.2 C at salt 1000.0mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: SG0145 Publication date: 05/05
PMID: 15131175 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 180 bp
MgCl2: mM dNTPs: mM Type: Q-RT-PCR
Temp (PCR cycle):95C 30sec>(95C 5sec>55C 15sec>72C 10sec)*45>40C 30sec
Buffer:
Polymerase: Cycler:
Note: Target range from sequence.

Total 25 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.