A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(IN-4) primer
Oligo ID:UM00152
Oligo type:
Denegeracy: 1
Target: 15601-15581 Tm: 68.5 C at salt 1000.0mMLength: 21
Sequence: TAACACACAACACCATCATCA
(0 other experimental conditions)
Note: IN-4 (this oligo) differs from IN-4 (-) in having an inosine replaced by an adenine. Target range from sequence.

Experimental condition used for the oligonucleotide

Common Data ID: UM0015 Publication date: 8/2003
PMID: 12690091 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS Coronavirus Product size (PCR): 452 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):45C 30min>95C 3min(95C 10sec>60C 10sec[-1C/cyc]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: Superscript II reverse transcriptase (RT)/platinum Taq pol one-step RT-PCR (InVitrogen)
Polymerase: Platinum Taq polyCycler: N/A
Note: IN-4 (this oligo) differs from IN-4 (-) in having an inosine replaced by an adenine. Target range from sequence.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.