A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:UM00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: UM0012 Publication date: 04/03
PMID: 12690092 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):N/A
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:UM00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SG0063 Publication date: 02/02
PMID: 15030702 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: 0.002 mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 30sec>50C 40sec>72C 60sec)*40
Buffer: 1x Buffer
Polymerase: Cycler:
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:UM00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SG0064 Publication date: 02/02
PMID: 15030702 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):50C 600sec>95C 600sec>(95C 2sec>55C 12sec>72C 10sec)*45
Buffer:
Polymerase: Cycler: Light Cycler (Roche)
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:UM00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 368 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:um00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: UM0012 Publication date: 04/03
PMID: 12690092 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):N/A
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:um00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SG0063 Publication date: 02/02
PMID: 15030702 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: 0.002 mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 30sec>50C 40sec>72C 60sec)*40
Buffer: 1x Buffer
Polymerase: Cycler:
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:um00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SG0064 Publication date: 02/02
PMID: 15030702 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):50C 600sec>95C 600sec>(95C 2sec>55C 12sec>72C 10sec)*45
Buffer:
Polymerase: Cycler: Light Cycler (Roche)
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:um00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 368 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:um00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: UM0012 Publication date: 04/03
PMID: 12690092 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):N/A
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:um00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SG0063 Publication date: 02/02
PMID: 15030702 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: 0.002 mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 30sec>50C 40sec>72C 60sec)*40
Buffer: 1x Buffer
Polymerase: Cycler:
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:um00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SG0064 Publication date: 02/02
PMID: 15030702 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):50C 600sec>95C 600sec>(95C 2sec>55C 12sec>72C 10sec)*45
Buffer:
Polymerase: Cycler: Light Cycler (Roche)
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:um00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 368 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:UM00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: UM0012 Publication date: 04/03
PMID: 12690092 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):N/A
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:UM00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SG0063 Publication date: 02/02
PMID: 15030702 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: 0.002 mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 30sec>50C 40sec>72C 60sec)*40
Buffer: 1x Buffer
Polymerase: Cycler:
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:UM00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SG0064 Publication date: 02/02
PMID: 15030702 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):50C 600sec>95C 600sec>(95C 2sec>55C 12sec>72C 10sec)*45
Buffer:
Polymerase: Cycler: Light Cycler (Roche)
Note: Target from sequence



Oligonucleotide information
Reverse(Cor-p-R1 (–)) primer
Oligo ID:UM00122
Oligo type:
Denegeracy: 1
Target: 15597-15617 Tm: 70.5 C at salt 1000.0mMLength: 21
Sequence: CAGGTAAGCGTAAAACTCATC
(4 other experimental conditions)
Note: Target from sequence

Experimental condition used for the oligonucleotide

Common Data ID: SA0003 Publication date: 12/03
PMID: 15070991 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 368 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: AmpliTaq Gold PCRCycler:
Note: Target from sequence

Total 16 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.