A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(SARSPol1 probe) primer
Oligo ID:TA006103
Oligo type: PCR Probe Denegeracy: 1
Target: 15366-15389 Tm: 78.7C at salt 1000.0 mMLength: 24
Sequence: ATGGTCATGTGTGGCGGCTCACTA
(2 other experimental conditions)
Note: FAM is on 5' end and TAMRA is on 3' end.

Experimental condition used for the oligonucleotide

Common Data ID: TA0061 Publication date: 11/03
PMID: 14633916 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):95C 5min>(94C 20sec>56C 1min)*40
Buffer:
Polymerase: Cycler:
Note: FAM is on 5' end and TAMRA is on 3' end.



Oligonucleotide information
Forward(SARSPol1 probe) primer
Oligo ID:TA006103
Oligo type: PCR Probe Denegeracy: 1
Target: 15366-15389 Tm: 78.7C at salt 1000.0 mMLength: 24
Sequence: ATGGTCATGTGTGGCGGCTCACTA
(2 other experimental conditions)
Note: FAM is on 5' end and TAMRA is on 3' end.

Experimental condition used for the oligonucleotide

Common Data ID: TA0062 Publication date: 8/04
PMID: 15178653 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: FAM is on 5' end and TAMRA is on 3' end.



Oligonucleotide information
Forward(SARSPol1 probe) primer
Oligo ID:TA006103
Oligo type: PCR Probe Denegeracy: 1
Target: 15366-15389 Tm: 78.7C at salt 1000.0 mMLength: 24
Sequence: ATGGTCATGTGTGGCGGCTCACTA
(2 other experimental conditions)
Note: FAM is on 5' end and TAMRA is on 3' end.

Experimental condition used for the oligonucleotide

Common Data ID: TA0061 Publication date: 11/03
PMID: 14633916 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):95C 5min>(94C 20sec>56C 1min)*40
Buffer:
Polymerase: Cycler:
Note: FAM is on 5' end and TAMRA is on 3' end.



Oligonucleotide information
Forward(SARSPol1 probe) primer
Oligo ID:TA006103
Oligo type: PCR Probe Denegeracy: 1
Target: 15366-15389 Tm: 78.7C at salt 1000.0 mMLength: 24
Sequence: ATGGTCATGTGTGGCGGCTCACTA
(2 other experimental conditions)
Note: FAM is on 5' end and TAMRA is on 3' end.

Experimental condition used for the oligonucleotide

Common Data ID: TA0062 Publication date: 8/04
PMID: 15178653 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: FAM is on 5' end and TAMRA is on 3' end.

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.