A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(TA005603) primer
Oligo ID:TA005603
Oligo type: Reverse Primer Denegeracy: 1
Target: 15480-15461 Tm: 70C at salt 1000.0 mMLength: 20
Sequence: ATTGGCTGTAACAGCTTGAC
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0056 Publication date: 09/04
PMID: 15349945 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 240, 438 bp
MgCl2: 2.5 mM dNTPs: mM Type: Multiplex RT-PCR
Temp (PCR cycle):94C 5min>(94C 30sec>55C 30sec>72C 30sec)*30>72C 7min
Buffer: 1XPCR buffer II
Polymerase: LA Taq DNA polyCycler: GeneAmp PCR system 2400 (Perkin-Elmer)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.