A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(COR-2) primer
Oligo ID:TA005002
Oligo type: Reverse Primer Denegeracy: 1
Target: 15628-15603 Tm: 72.6C at salt 1000.0 mMLength: 26
Sequence: AAATGTTTACGCAGGTAAGCGTAAAA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: TA0050 Publication date: 05/04
PMID: 15200815 GI: 30271926 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 45sec>60C 45sec>72C 45sec)*45>72C 7min
Buffer: 1.2mM Magnesium sulphate
Polymerase: Platinum Taq (Invitrogen)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.