A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(N2.3) primer
Oligo ID:SW00860
Oligo type: PCR Denegeracy: 1
Target: 127-146 Tm: 67.9 C at salt 1000.0mMLength: 20
Sequence: CATCTCAATAAGTTGTGTGG
(1 other experimental conditions)
Note: Specific to N gene.

Experimental condition used for the oligonucleotide

Common Data ID: SW0086 Publication date: 11/00
PMID: 11044116 GI: 450251 Taxonomy ID:11246
Virus Name: Bovine respiratory syncytial virus, BRSV Product size (PCR):
bp
MgCl2: 1.0 mM dNTPs: 200 mM Type: RT-nested PCR 2
Temp (PCR cycle):94C 12min>(94C 45sec>49C 60sec>72C 60sec)*35>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL AmpliTaq Gold poly (Perkin-Elmer)Cycler: GeneAmp PCR system 480 (Perkin-Elmer)
Note: Specific to N gene.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.