A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SW00552) primer
Oligo ID:SW00552
Oligo type: Hybridization Denegeracy: 1
Target: 702-681 Tm: 80.3 C at salt 1000.0mMLength: 22
Sequence: GAACCTGCCCACGCGCTGAAAC
(1 other experimental conditions)
Note: Specific to BHV-1 gC gene.

Experimental condition used for the oligonucleotide

Common Data ID: SW0055 Publication date: 02/97
PMID: 9066027 GI: 330754 Taxonomy ID:10323
Virus Name: Bovine herpesvirus type 1.1 (strain Cooper) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):(94C 1min>65C 1min>72C 2min[+3.5sec/cyc])*40>72C 7min
Buffer: PCR buffer
Polymerase: 0.05U/microL Taq polyCycler:
Note: Specific to BHV-1 gC gene.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.