A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(P6) primer
Oligo ID:SW00535
Oligo type: Denegeracy: 1
Target: 3208-3229 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: CTGGTTCAGAAGGAATGGCCCG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.