A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0391 Publication date: 08/97
PMID: 9274816 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): 131 bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0316 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0391 Publication date: 08/97
PMID: 9274816 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): 131 bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0316 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0391 Publication date: 08/97
PMID: 9274816 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): 131 bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0316 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0391 Publication date: 08/97
PMID: 9274816 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): 131 bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0316 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0391 Publication date: 08/97
PMID: 9274816 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): 131 bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0316 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0391 Publication date: 08/97
PMID: 9274816 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): 131 bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0316 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0391 Publication date: 08/97
PMID: 9274816 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): 131 bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0316 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0391 Publication date: 08/97
PMID: 9274816 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): 131 bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:SW00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0316 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0285 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL) Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM0286 Publication date: 1996
PMID: 8634024 GI: 61076 Taxonomy ID:12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0307 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0391 Publication date: 08/97
PMID: 9274816 GI: 61076 Taxonomy ID:12111
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): 131 bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0393 Publication date: 08/97
PMID: 9274816 GI: 6572136 Taxonomy ID:35292
Virus Name: Foot-and-mouth disease virus SAT 2 Product size (PCR): 75 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0394 Publication date: 08/97
PMID: 9274816 GI: 576561 Taxonomy ID:12123
Virus Name: Foot-and-mouth disease virus SAT 3 Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:sw00530
Oligo type: Denegeracy: 1
Target: 3851-3832 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0316 Publication date: 12/99
PMID: 10598089 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note:

Total 72 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.