A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SW00511) primer
Oligo ID:SW00511
Oligo type: PCR Denegeracy: 1
Target: 6342-6323 Tm: 70 C at salt 1000.0mMLength: 20
Sequence: TTTGGTTGAGGCATTTGGCA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SW0051 Publication date: 07/98
PMID: 9713819 GI: 9626649 Taxonomy ID:11099
Virus Name: pestivirus type 1, BVDV Product size (PCR):
bp
MgCl2: 1.0 mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):94C 2min>(95C 1min>55C 1min>72C 1min)*50>72C 7min
Buffer: 1x PCR buffer (Perkin Elmer)
Polymerase: 0.025U/microL AmpliTaq Gold DNA poly (Perkin Elmer)Cycler: thermal cycler (Perkin Elmer)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.