A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(R) primer
Oligo ID:SW00401
Oligo type: PCR Denegeracy: 1
Target: 392-373 Tm: 72 C at salt 1000.0mMLength: 20
Sequence: ACTCCATGTGCCATGTACAG
(5 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SW0040 Publication date: 07/97
PMID: 9403511 GI: 9626649 Taxonomy ID:11099
Virus Name: pestivirus type 1, BVDV Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 30sec>55C 100sec>72C 100sec)*30
Buffer: 16mM Tris-HCl, 98mM KCl, 500ng/microL BSA, 0.1% sodium cholate, 0.1% Triton X-100, 0.06mM DTT, 6microM disodium ethylenediaminetetraacetate, 3% glycerol
Polymerase: 0.025U/microL Tth DNA poly (Toyobo Co.; Tokyo, Japan)Cycler: TSR-300 thermal cycler (Iwaki Glass Co.; Tokyo, Japan)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.