A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(P2) primer
Oligo ID:SW00341
Oligo type: PCR Denegeracy: 1
Target: 124-147 Tm: 85.5 C at salt 1000.0mMLength: 24
Sequence: CGTAGTGGCGAGCTCCCTGGGTGG
(0 other experimental conditions)
Note: Specific to CSFV [GI:9626724]

Experimental condition used for the oligonucleotide

Common Data ID: SW0034 Publication date: 02/96
PMID: 9054133 GI: 9626649 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV; Hog cholera virus (strain Alfort), CSFV Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 3min>(94C 1min>65C 1min>72C 1min)*35
Buffer: 10mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.008U/microL Taq DNA poly (CENBIOT)Cycler: PTC-100 (MJ Research)
Note: Specific to CSFV [GI:9626724]

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.