A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(primer 2) primer
Oligo ID:SW00241
Oligo type: PCR Denegeracy: 1
Target: 698-669 Tm: 75.2 C at salt 1000.0mMLength: 30
Sequence: ATGTATGCCCAAAACTTATAATATGACCAG
(1 other experimental conditions)
Note: Used with primer 1 for primary PCR.

Experimental condition used for the oligonucleotide

Common Data ID: SW0024 Publication date: 05/96
PMID: 8727882 GI: 261087 Taxonomy ID:10385
Virus Name: Bovine herpesvirus 4, BHV-4 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.1 mM Type: Nested PCR
Temp (PCR cycle):(94C 45sec>56C 60sec>72C 90sec)*5>(94C 45sec>51C 60sec>72C 90sec)*25>72C 7min
Buffer: 1x PCR buffer
Polymerase: 0.2U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler: TRIO-thermoblock (Biometra; Gottingen, Germany))
Note: Used with primer 1 for primary PCR.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.