A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P2) primer
Oligo ID:SW00201
Oligo type: PCR Denegeracy: 1
Target: 935-914 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: TGTGACTTGGTGCCCATGTCGC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SW0020 Publication date: 12/93
PMID: 8308103 GI: 330754 Taxonomy ID:10323
Virus Name: Bovine herpesvirus type 1.1 (strain Cooper) Product size (PCR):
bp
MgCl2: 1.9 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):(95C 1min>60C 1min>72C 1min)*15>(95C 1min>60C 1min>72C 1min [+4sec/cyc])*23
Buffer: 10mM Tris (pH 9.0), 50mM KCl, 0.01% gelatin, 5% glycerol
Polymerase: 0.01U/microL Taq poly (Boehringer)Cycler: DNA thermal cycler (Perkin-Elmer Cetus)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.