A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P2) primer
Oligo ID:SW00191
Oligo type: PCR Denegeracy: 1
Target: 1473-1452 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: CTACCGTCACGTGCTGTGTACG
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SW0019 Publication date: 12/96
PMID: 8997877 GI: 330756 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR): 468 bp
MgCl2: N/A mM dNTPs: 0.8 mM Type: PCR
Temp (PCR cycle):96C 6min>(95C 1min>58C 1min>72C 1min)*35
Buffer: 5microL Taq polymerase buffer (Perkin-Elmer), 4% DMSO
Polymerase: 0.02U/microL AmpliTaq DNA poly (Perkin-Elmer)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.