A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SW00161) primer
Oligo ID:SW00161
Oligo type: PCR Denegeracy: 1
Target: 670-650 Tm: 84.2 C at salt 1000.0mMLength: 21
Sequence: CCCCGGCCGGCAGCGAAACCA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SW0016 Publication date: 05/92
PMID: 1314454 GI: 330745 Taxonomy ID:10323
Virus Name: Bovine herpesvirus type 1.1 (strain Cooper) Product size (PCR): 353 bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):(94C 2min>67C 1min>74C 1min)*40>74C 5min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 4.0% dimethyl sulfoxide
Polymerase: 0.025U/microL AmpliTaq poly (Perkin-Elmer Cetus)Cycler: Model 50 Tempcycler (Coy Laboratory Prod. Inc.)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.