A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database

Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

°C± °C
Oligo length:
bp± bp


Common Data ID:

Taxonomy ID:

GI Number:

Oligonucleotide information
Reverse(SW000101) primer
Oligo ID:SW00011
Oligo type: Denegeracy: 1
Tm: 75.2 C at salt 1000.0mMLength: 30
Sequence: atgtatgcccaaaacttataatatgaccag
(1 other experimental conditions)

Experimental condition used for the oligonucleotide

Common Data ID: KO0001 Publication date: 07/00
PMID: 10889405 GI: 221806 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV1 Product size (PCR): 298 bp
MgCl2: 12 mM dNTPs: 1.25 mM Type: PCR
Temp (PCR cycle):98C 5min>(98C 30sec>63C 30sec>75C 40sec)*35>74C 5min
Buffer: 8% DMSO
Polymerase: 0.0125U/microL DNA poly PFU (Stratagene)Cycler:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.