A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(B8) primer
Oligo ID:SH00098
Oligo type: PCR Denegeracy: 1
Target: 5376-5352 Tm: 77.2 C at salt 1000.0mMLength: 25
Sequence: GCTAGTTCTGTGGTGGATTGTTGTC
(3 other experimental conditions)
Note: Used with B7A for secondary PCR. BLAST position differs from that in article (651-627).

Experimental condition used for the oligonucleotide

Common Data ID: SH0009 Publication date: 09/94
PMID: 7814551 GI: 9631267 Taxonomy ID:11246
Virus Name: Bovine respiratory syncytial virus, BRSV Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR
Temp (PCR cycle):(94C 45sec>50C 45sec>72C 90sec)*25>72C 6min
Buffer: 10mM Tris-HCl (pH 9.0), 50 mM KCl, 100ng/microL BSA
Polymerase: 0.02U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: Used with B7A for secondary PCR. BLAST position differs from that in article (651-627).



Oligonucleotide information
Reverse(B8) primer
Oligo ID:SH00098
Oligo type: PCR Denegeracy: 1
Target: 5376-5352 Tm: 77.2 C at salt 1000.0mMLength: 25
Sequence: GCTAGTTCTGTGGTGGATTGTTGTC
(3 other experimental conditions)
Note: Used with B7A for secondary PCR. BLAST position differs from that in article (651-627).

Experimental condition used for the oligonucleotide

Common Data ID: SG0159 Publication date: 2003
PMID: 12916694 GI: 9631267 Taxonomy ID:11246
Virus Name: Bovine respiratory syncytial virus Product size (PCR): 371 bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 45sec>50C 45sec>72C 90sec)*25>72C 6min
Buffer: 10mM Tris-HCl (pH 9.0), 50 mM KCl, 100ng/microL BSA
Polymerase: 0.02U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: Used with B7A for secondary PCR. BLAST position differs from that in article (651-627).



Oligonucleotide information
Reverse(B8) primer
Oligo ID:sh00098
Oligo type: PCR Denegeracy: 1
Target: 5376-5352 Tm: 77.2 C at salt 1000.0mMLength: 25
Sequence: GCTAGTTCTGTGGTGGATTGTTGTC
(3 other experimental conditions)
Note: Used with B7A for secondary PCR. BLAST position differs from that in article (651-627).

Experimental condition used for the oligonucleotide

Common Data ID: SH0009 Publication date: 09/94
PMID: 7814551 GI: 9631267 Taxonomy ID:11246
Virus Name: Bovine respiratory syncytial virus, BRSV Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR
Temp (PCR cycle):(94C 45sec>50C 45sec>72C 90sec)*25>72C 6min
Buffer: 10mM Tris-HCl (pH 9.0), 50 mM KCl, 100ng/microL BSA
Polymerase: 0.02U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: Used with B7A for secondary PCR. BLAST position differs from that in article (651-627).



Oligonucleotide information
Reverse(B8) primer
Oligo ID:sh00098
Oligo type: PCR Denegeracy: 1
Target: 5376-5352 Tm: 77.2 C at salt 1000.0mMLength: 25
Sequence: GCTAGTTCTGTGGTGGATTGTTGTC
(3 other experimental conditions)
Note: Used with B7A for secondary PCR. BLAST position differs from that in article (651-627).

Experimental condition used for the oligonucleotide

Common Data ID: SG0159 Publication date: 2003
PMID: 12916694 GI: 9631267 Taxonomy ID:11246
Virus Name: Bovine respiratory syncytial virus Product size (PCR): 371 bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 45sec>50C 45sec>72C 90sec)*25>72C 6min
Buffer: 10mM Tris-HCl (pH 9.0), 50 mM KCl, 100ng/microL BSA
Polymerase: 0.02U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: Used with B7A for secondary PCR. BLAST position differs from that in article (651-627).

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.