A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(GeneMb) primer
Oligo ID:SG015104
Oligo type: Reverse Primer Denegeracy: 1
Target: 26801-26781 Tm: 74.4C at salt 1000.0 mMLength: 21
Sequence: TCACTTTCCATGAGCGGTCTG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0151 Publication date: 07/04
PMID: 15243096 GI: 38505482 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Multiplex PCR
Temp (PCR cycle):95C 180sec>(95C 60sec>50C 60sec>72C 60sec)*35
Buffer: 5microL master buffer (Bio-ID Diagnostic Inc.)
Polymerase: 5U Taq poly (Roche Diagnostic)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.