A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(SANP1) primer
Oligo ID:SG014902
Oligo type: PCR Probe Denegeracy: 1
Target: 28185-28208 Tm: 77C at salt 1000.0 mMLength: 24
Sequence: TAACCAGAATGGAGGACGCAATGG
(0 other experimental conditions)
Note: This probe has a 6-carboxyfluorescein on the 5' end and a 6-carboxy-N,N,N',N'-tetramethylrhodamine on the 3' end

Experimental condition used for the oligonucleotide

Common Data ID: SG0149 Publication date: 05/04
PMID: 15131168 GI: 33114190 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 600sec>95C 180sec>(95C 2sec>55C 12sec>72C 10sec)*50
Buffer:
Polymerase: Cycler:
Note: This probe has a 6-carboxyfluorescein on the 5' end and a 6-carboxy-N,N,N',N'-tetramethylrhodamine on the 3' end

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.