A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(Pox RT 14kb 1) primer
Oligo ID:SG013803
Oligo type: Reverse Primer Denegeracy: 1
Target: 131911-131885 Tm: 71.4C at salt 1000.0 mMLength: 27
Sequence: ACAAATIGAAAAGTGTTGTAAACGCAA
(0 other experimental conditions)
Note: Set 1

Experimental condition used for the oligonucleotide

Common Data ID: SG0138 Publication date: 05/04
PMID: 15131152 GI: 5830555 Taxonomy ID:10255
Virus Name: Variola virus Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time PCR
Temp (PCR cycle):95C 10sec>(95C 5sec>55C 15sec>72C 15sec)*45
Buffer:
Polymerase: Cycler: LightCycler (Roche Diagnostics)
Note: Set 1

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.