A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(NS TM) primer
Oligo ID:SG011806
Oligo type: PCR Probe Denegeracy: 1
Target: 14445-14414 Tm: 80.7C at salt 1000.0 mMLength: 32
Sequence: CATCCTGATTATGTACGACTCCTAACCACGAA
(1 other experimental conditions)
Note: There is a 6-carboxyfluorescein attatched to the 5' terminus, and a 5-TAMRA attached to 5-ethylamino-dThymidin at nt 14419.

Experimental condition used for the oligonucleotide

Common Data ID: SG0118 Publication date: 07/04
PMID: 15324554 GI: 30248028 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 88 bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 15sec>60C 30sec)*45
Buffer:
Polymerase: Cycler: Applied Biosystems real-time PCR systems SDS7700 SDS7000 (Applied Biosystems)
Note: There is a 6-carboxyfluorescein attatched to the 5' terminus, and a 5-TAMRA attached to 5-ethylamino-dThymidin at nt 14419.



Oligonucleotide information
Reverse(NS TM) primer
Oligo ID:SG011806
Oligo type: PCR Probe Denegeracy: 1
Target: 14445-14414 Tm: 80.7C at salt 1000.0 mMLength: 32
Sequence: CATCCTGATTATGTACGACTCCTAACCACGAA
(1 other experimental conditions)
Note: There is a 6-carboxyfluorescein attatched to the 5' terminus, and a 5-TAMRA attached to 5-ethylamino-dThymidin at nt 14419.

Experimental condition used for the oligonucleotide

Common Data ID: SG0119 Publication date: 07/04
PMID: 15324554 GI: 30248028 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 88 bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):55C 1800sec>95C 30sec>(95C 1sec>55C 10sec>72C 10sec)*45
Buffer:
Polymerase: Cycler: Roche LightCycler (Roche Diagnostics)
Note: There is a 6-carboxyfluorescein attatched to the 5' terminus, and a 5-TAMRA attached to 5-ethylamino-dThymidin at nt 14419.



Oligonucleotide information
Reverse(NS TM) primer
Oligo ID:sg011806
Oligo type: PCR Probe Denegeracy: 1
Target: 14445-14414 Tm: 80.7C at salt 1000.0 mMLength: 32
Sequence: CATCCTGATTATGTACGACTCCTAACCACGAA
(1 other experimental conditions)
Note: There is a 6-carboxyfluorescein attatched to the 5' terminus, and a 5-TAMRA attached to 5-ethylamino-dThymidin at nt 14419.

Experimental condition used for the oligonucleotide

Common Data ID: SG0118 Publication date: 07/04
PMID: 15324554 GI: 30248028 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 88 bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 15sec>60C 30sec)*45
Buffer:
Polymerase: Cycler: Applied Biosystems real-time PCR systems SDS7700 SDS7000 (Applied Biosystems)
Note: There is a 6-carboxyfluorescein attatched to the 5' terminus, and a 5-TAMRA attached to 5-ethylamino-dThymidin at nt 14419.



Oligonucleotide information
Reverse(NS TM) primer
Oligo ID:sg011806
Oligo type: PCR Probe Denegeracy: 1
Target: 14445-14414 Tm: 80.7C at salt 1000.0 mMLength: 32
Sequence: CATCCTGATTATGTACGACTCCTAACCACGAA
(1 other experimental conditions)
Note: There is a 6-carboxyfluorescein attatched to the 5' terminus, and a 5-TAMRA attached to 5-ethylamino-dThymidin at nt 14419.

Experimental condition used for the oligonucleotide

Common Data ID: SG0119 Publication date: 07/04
PMID: 15324554 GI: 30248028 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 88 bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):55C 1800sec>95C 30sec>(95C 1sec>55C 10sec>72C 10sec)*45
Buffer:
Polymerase: Cycler: Roche LightCycler (Roche Diagnostics)
Note: There is a 6-carboxyfluorescein attatched to the 5' terminus, and a 5-TAMRA attached to 5-ethylamino-dThymidin at nt 14419.

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.