A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SG011302) primer
Oligo ID:SG011302
Oligo type: Reverse Primer Denegeracy: 1
Target: 57666-57645 Tm: 82.2C at salt 1000.0 mMLength: 22
Sequence: GCTCCGGCGAGTAGCTGGTGTG
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0113 Publication date: 10/03
PMID: 14532175 GI: 33772319 Taxonomy ID:35244
Virus Name: Bovine herpesvirus 5 Product size (PCR): 273 bp
MgCl2: 1 mM dNTPs: 10 mM Type: PCR
Temp (PCR cycle):94C 600sec>(94C 60sec>50C 30sec>72C 30sec)*40>72C 420sec
Buffer: 1x reaction buffer
Polymerase: 0.5U Taq poly (GIBCO BRL)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.