A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(OPXJ7R3U) primer
Oligo ID:SG011101
Oligo type: Forward Primer Denegeracy: 1
Target: 151629-151649 Tm: 70.5C at salt 1000.0 mMLength: 21
Sequence: TCATCTGGAGAATCCACAACA
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0111 Publication date: 08/03
PMID: 12904397 GI: 623595 Taxonomy ID:12870
Virus Name: Variola major virus Product size (PCR): bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: Real-time PCR
Temp (PCR cycle):95C 120sec>(95C 10sec>60C 45sec)*45
Buffer: 50mM Tris (pH 8.3), 25microG bovine serum albumin per ml
Polymerase: 1.35U Platinum Taq poly (Invitrogen)Cycler: Smart Cycler
Note:



Oligonucleotide information
Forward(OPXJ7R3U) primer
Oligo ID:SG011101
Oligo type: Forward Primer Denegeracy: 1
Target: 151629-151649 Tm: 70.5C at salt 1000.0 mMLength: 21
Sequence: TCATCTGGAGAATCCACAACA
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0112 Publication date: 08/03
PMID: 12904397 GI: 623595 Taxonomy ID:12870
Virus Name: Variola major virus Product size (PCR): bp
MgCl2: 7 mM dNTPs: 0.2 mM Type: Real-time PCR
Temp (PCR cycle):95C 120sec>(95C 1sec>60C 20sec)*45
Buffer: 50mM Tris (pH 8.3), 25microG bovine serum albumin per mL
Polymerase: 0.8U Platinum TaqDNA (Invitrogen)Cycler: LightCycler
Note:



Oligonucleotide information
Forward(OPXJ7R3U) primer
Oligo ID:sg011101
Oligo type: Forward Primer Denegeracy: 1
Target: 151629-151649 Tm: 70.5C at salt 1000.0 mMLength: 21
Sequence: TCATCTGGAGAATCCACAACA
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0111 Publication date: 08/03
PMID: 12904397 GI: 623595 Taxonomy ID:12870
Virus Name: Variola major virus Product size (PCR): bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: Real-time PCR
Temp (PCR cycle):95C 120sec>(95C 10sec>60C 45sec)*45
Buffer: 50mM Tris (pH 8.3), 25microG bovine serum albumin per ml
Polymerase: 1.35U Platinum Taq poly (Invitrogen)Cycler: Smart Cycler
Note:



Oligonucleotide information
Forward(OPXJ7R3U) primer
Oligo ID:sg011101
Oligo type: Forward Primer Denegeracy: 1
Target: 151629-151649 Tm: 70.5C at salt 1000.0 mMLength: 21
Sequence: TCATCTGGAGAATCCACAACA
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0112 Publication date: 08/03
PMID: 12904397 GI: 623595 Taxonomy ID:12870
Virus Name: Variola major virus Product size (PCR): bp
MgCl2: 7 mM dNTPs: 0.2 mM Type: Real-time PCR
Temp (PCR cycle):95C 120sec>(95C 1sec>60C 20sec)*45
Buffer: 50mM Tris (pH 8.3), 25microG bovine serum albumin per mL
Polymerase: 0.8U Platinum TaqDNA (Invitrogen)Cycler: LightCycler
Note:

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.