A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(SG010001) primer
Oligo ID:SG010001
Oligo type: Forward Primer Denegeracy: 1
Target: 28531-28552 Tm: 74.7C at salt 1000.0 mMLength: 22
Sequence: GGAGCCTTGAATACACCCAAAG
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0100 Publication date: 03/04
PMID: 15004042 GI: 30027617 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 66 bp
MgCl2: mM dNTPs: mM Type: Real-time PCR
Temp (PCR cycle):50C 120sec>95C 600sec>(95C 15sec>60C 60sec)*40
Buffer:
Polymerase: Cycler: ABI Prism 7700 (Applied Biosystems)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.