A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SG009903) primer
Oligo ID:SG009903
Oligo type: Reverse Primer Denegeracy: 1
Target: 15657-15634 Tm: 71.9C at salt 1000.0 mMLength: 24
Sequence: GGCATCATCAGAAAGAATCATCAT
(0 other experimental conditions)
Note: Outer primer. This is the primer used in the RT.

Experimental condition used for the oligonucleotide

Common Data ID: SG0099 Publication date: 01/04
PMID: 14715775 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):94C 10sec>(94C 10sec>50C 30sec>72C 60sec)*35>72C 420sec
Buffer:
Polymerase: Cycler:
Note: Outer primer. This is the primer used in the RT.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.