A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(SG009001) primer
Oligo ID:SG009001
Oligo type: Forward Primer Denegeracy: 1
Target: 17718-17742 Tm: 73.9C at salt 1000.0 mMLength: 25
Sequence: CAGAACGCTGTAGCTTCAAAAATCT
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0090 Publication date: 2003
PMID: 14522060 GI: 38505491 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 5.5 mM dNTPs: 0.2 mM Type: Real-time RT-PCR
Temp (PCR cycle):50C 120sec>95C 600sec>(95C 15sec>60C 60sec)*45
Buffer: 1x Taqman buffer A
Polymerase: 0.625U AmpliTaq Gold poly (Applied Biosystems)Cycler: 7000 Seqeunce Detection system (Applied Biosystems)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.