A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(SG008601) primer
Oligo ID:SG008601
Oligo type: Forward Primer Denegeracy: 1
Target: 17718-17742 Tm: 73.9C at salt 1000.0 mMLength: 25
Sequence: CAGAACGCTGTAGCTTCAAAAATCT
(2 other experimental conditions)
Note: Located on the ORF1b region of the SARS-CoV genome.

Experimental condition used for the oligonucleotide

Common Data ID: SG0086 Publication date: 2004
PMID: 15135737 GI: 33578015 Taxonomy ID:227859
Virus Name: SARS coronavirus FRA Product size (PCR): bp
MgCl2: mM dNTPs: 0.300 mM Type: RT-PCR
Temp (PCR cycle):50C 120sec>60C 1800sec>95C 300sec>(94C 15sec>58C 60sec)*50
Buffer: 1x TaqMan EZ buffer
Polymerase: 2.5U rTth poly (Applied Biosystems)Cycler: 7000 Sequence Detection System (Applied Biosystems)
Note: Located on the ORF1b region of the SARS-CoV genome.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.