A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(COR-2) primer
Oligo ID:SG007602
Oligo type: Reverse Primer Denegeracy: 1
Target: 15529-15504 Tm: 72.6C at salt 1000.0 mMLength: 26
Sequence: AAATGTTTACGCAGGTAAGCGTAAAA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 310 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Reverse(COR-2) primer
Oligo ID:SG007602
Oligo type: Reverse Primer Denegeracy: 1
Target: 15529-15504 Tm: 72.6C at salt 1000.0 mMLength: 26
Sequence: AAATGTTTACGCAGGTAAGCGTAAAA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0078 Publication date: 09/03
PMID: 14519240 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 310 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>94C 180sec>(94C 30sec>52C 30sec>72C 45sec)*40>72C 420sec
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Reverse(COR-2) primer
Oligo ID:sg007602
Oligo type: Reverse Primer Denegeracy: 1
Target: 15529-15504 Tm: 72.6C at salt 1000.0 mMLength: 26
Sequence: AAATGTTTACGCAGGTAAGCGTAAAA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 310 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Reverse(COR-2) primer
Oligo ID:sg007602
Oligo type: Reverse Primer Denegeracy: 1
Target: 15529-15504 Tm: 72.6C at salt 1000.0 mMLength: 26
Sequence: AAATGTTTACGCAGGTAAGCGTAAAA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0078 Publication date: 09/03
PMID: 14519240 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 310 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>94C 180sec>(94C 30sec>52C 30sec>72C 45sec)*40>72C 420sec
Buffer:
Polymerase: Cycler:
Note:

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.