A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(Cor-p-F2) primer
Oligo ID:SG007203
Oligo type: Forward Primer Denegeracy: 1
Target: 15250-15270 Tm: 68.5C at salt 1000.0 mMLength: 21
Sequence: CTAACATGCTTAGGATAATGG
(4 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0072 Publication date: 09/03
PMID: 14519257 GI: 30698326 Taxonomy ID:229993
Virus Name: SARS coronavirus TW1 Product size (PCR): 368 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.