A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SG007017) primer
Oligo ID:SG007017
Oligo type: Reverse Primer Denegeracy: 1
Target: 27027-27005 Tm: 71.5C at salt 1000.0 mMLength: 23
Sequence: CGGCGTGGTCTGTATTTAATTTA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0070 Publication date: 02/04
PMID: 15030703 GI: 33578015 Taxonomy ID:242743
Virus Name: SARS coronavirus FRA Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time RT-PCR
Temp (PCR cycle):48C 1800sec>95C 600sec>(95C 15sec>60C 60sec)*45
Buffer:
Polymerase: Cycler: iCycler iQ Real-Time Detection System (Bio-Rad)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.