A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(COR-1) primer
Oligo ID:SG006501
Oligo type: Forward Primer Denegeracy: 1
Target: 15318-15343 Tm: 77.3C at salt 1000.0 mMLength: 26
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0065 Publication date: 11/03
PMID: 14718079 GI: 33578015 Taxonomy ID:242743
Virus Name: SARS coronavirus FRA Product size (PCR): 311 bp
MgCl2: 25 mM dNTPs: 2.5 mM Type: Q-RT-PCR
Temp (PCR cycle):94C 180sec>(94C 30sec>60C 30sec>72C 60sec)*45>72C 7min
Buffer: 1.1x buffer (Amersham Pharmacia Biotech)
Polymerase: 5U/mL Taq polyCycler: GeneAmp PCR System 9700 (Applied Biosystem)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.