A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(Taq-772F) primer
Oligo ID:SG006201
Oligo type: Forward Primer Denegeracy: 1
Target: 28891-28910 Tm: 72C at salt 1000.0 mMLength: 20
Sequence: AAGCCTCGCCAAAAACGTAC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0062 Publication date: 02/04
PMID: 15030701 GI: 33578015 Taxonomy ID:242743
Virus Name: SARS coronavirus FRA Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: Real-time PCR
Temp (PCR cycle):50C 120sec>95C 600sec>(95C 15sec>61C 60sec)*45
Buffer:
Polymerase: Cycler: ABI Prism 7900 HT (PE Applied Biosystems)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.