A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(REP3) primer
Oligo ID:SG005703
Oligo type: Hybridization Probe Denegeracy: 1
Target: 967-931 Tm: 88.6C at salt 1000.0 mMLength: 37
Sequence: TGCTCATGGTCACGGCAGCAGTAGACACCTCTCTTCG
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.

Experimental condition used for the oligonucleotide

Common Data ID: SG0057 Publication date: 2004
PMID: 15080310 GI: 31416305 Taxonomy ID:228409
Virus Name: SARS coronavirus BJ03 Product size (PCR): bp
MgCl2: mM dNTPs: mM Type: In situ hybridization
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Probe has a fluorescein isothiocyanate at the 5' end.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.