A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(pf2) primer
Oligo ID:SG005504
Oligo type: PCR Probe Denegeracy: 1
Target: 1008-1034 Tm: 83.6C at salt 1000.0 mMLength: 27
Sequence: CGGAGACGACATCGTGGTGGCAAGTGA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0055 Publication date: 2004
PMID: 15168202 GI: 732696 Taxonomy ID:12110
Virus Name: Foot-and-mouth disease virus Product size (PCR): 232 bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):48C 900sec>94C 90sec>(94C 30sec>48C 30sec>72C 40sec)*35>72C 300sec
Buffer: 100mM Tris-HCl (pH 9.0)
Polymerase: 0.8U Taq poly (Roche)Cycler: GenAmpPCR 9700 (Perkin-Elmer, Applied Biosystem)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.