A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:SG004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0048 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: 2 mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):95C 600sec>(95C 10sec>56C 5sec>72C 5sec)*35
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:SG004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:SG004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:SG004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:SG004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0130 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 108 bp
MgCl2: 2.5 mM dNTPs: 2.0 mM Type: PCR
Temp (PCR cycle):95C 300sec>(95C 10sec>60C (-1C/cyc) 10sec>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*20
Buffer: 1x reaction buffer
Polymerase: 2U AmpliTaq GoldCycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0048 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: 2 mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):95C 600sec>(95C 10sec>56C 5sec>72C 5sec)*35
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0130 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 108 bp
MgCl2: 2.5 mM dNTPs: 2.0 mM Type: PCR
Temp (PCR cycle):95C 300sec>(95C 10sec>60C (-1C/cyc) 10sec>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*20
Buffer: 1x reaction buffer
Polymerase: 2U AmpliTaq GoldCycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0048 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: 2 mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):95C 600sec>(95C 10sec>56C 5sec>72C 5sec)*35
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0130 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 108 bp
MgCl2: 2.5 mM dNTPs: 2.0 mM Type: PCR
Temp (PCR cycle):95C 300sec>(95C 10sec>60C (-1C/cyc) 10sec>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*20
Buffer: 1x reaction buffer
Polymerase: 2U AmpliTaq GoldCycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0048 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: 2 mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):95C 600sec>(95C 10sec>56C 5sec>72C 5sec)*35
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0130 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 108 bp
MgCl2: 2.5 mM dNTPs: 2.0 mM Type: PCR
Temp (PCR cycle):95C 300sec>(95C 10sec>60C (-1C/cyc) 10sec>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*20
Buffer: 1x reaction buffer
Polymerase: 2U AmpliTaq GoldCycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0048 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: 2 mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):95C 600sec>(95C 10sec>56C 5sec>72C 5sec)*35
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 110 bp
MgCl2: mM dNTPs: mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Reverse(BNIAs) primer
Oligo ID:sg004802
Oligo type: Reverse Primer Denegeracy: 1
Target: 18310-18289 Tm: 72.9C at salt 1000.0 mMLength: 22
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0130 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 108 bp
MgCl2: 2.5 mM dNTPs: 2.0 mM Type: PCR
Temp (PCR cycle):95C 300sec>(95C 10sec>60C (-1C/cyc) 10sec>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*20
Buffer: 1x reaction buffer
Polymerase: 2U AmpliTaq GoldCycler:
Note:

Total 25 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.