A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:SG004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0047 Publication date: 12/03
PMID: 14699465 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0073 Publication date: 01/04
PMID: 15078592 GI: 3796831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0074 Publication date: 03/04
PMID: 15109406 GI: 30698326 Taxonomy ID:258445
Virus Name: SARS coronavirus TW1 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec [-1C/cycle]>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x buffer
Polymerase: 0.4microL Taq polyCycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0076 Publication date: 02/04
PMID: 15030711 GI: 37960831 Taxonomy ID:258445
Virus Name: SARS coronavirus GD69 Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS) primer
Oligo ID:sg004701
Oligo type: Forward Primer Denegeracy: 1
Target: 18154-18177 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0129 Publication date: 10/03
PMID: 14532176 GI: 37960831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 189 bp
MgCl2: 2.45 mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):45C 1800sec>95C 180sec>(95C 10sec>60C(-1C/cyc) 10sec>72C 30sec)*10>(95C 10sec>56C 10sec>72C 30sec)*40
Buffer: 1x reaction buffer
Polymerase: Cycler:
Note:

Total 25 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.