A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(OPS3) primer
Oligo ID:SG004601
Oligo type: Forward Primer Denegeracy: 1
Target: 17-40 Tm: 65C at salt 1000.0 mMLength: 24
Sequence: TACTTTTGTTACTAATATCATTAG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0046 Publication date: 2004
PMID: 14962998 GI: 510229 Taxonomy ID:10255
Virus Name: Variola virus Product size (PCR): 160 bp
MgCl2: 3.3 mM dNTPs: 0.2 mM Type: Real-time PCR
Temp (PCR cycle):94C 360sec>(94C 5sec>51C 10sec>72C 15sec)*40
Buffer: 1X Platinum Taq polymerase reaction buffer (Invitrogen)
Polymerase: 1U Platinum Taq poly (Invitrogen)Cycler: Roche LightCycler
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.