A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(Probe E) primer
Oligo ID:SG004203
Oligo type: PCR Probe Denegeracy: 1
Target: 18215-18237 Tm: 78.6C at salt 1000.0 mMLength: 23
Sequence: CGTTCGTGCGTGGATTGGCTTTG
(0 other experimental conditions)
Note: This is a fluorogenic probe.

Experimental condition used for the oligonucleotide

Common Data ID: SG0042 Publication date: 2003
PMID: 14652014 GI: 30248028 Taxonomy ID:227984
Virus Name: SARS coronavirus Tor2 Product size (PCR): 67 bp
MgCl2: mM dNTPs: 0.2 mM Type: Real-time PCR
Temp (PCR cycle):50C 120sec>95C 600sec>(95C 15sec>58C 60sec)*40
Buffer:
Polymerase: Hotstart Taq polyCycler: ABI Prism 7700 Sequence Detector (Applied Biosystems)
Note: This is a fluorogenic probe.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.