A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0041 Publication date: 2003
PMID: 14652014 GI: 30248028 Taxonomy ID:227984
Virus Name: SARS coronavirus Tor2 Product size (PCR): 166 bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec[-1C/Cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer
Polymerase: 0.04U/microL Taq DNA polymerase (Invitrogen)Cycler: MasterCycler (Eppendorf)
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0123 Publication date: 02/04
PMID: 15030680 GI: 33578015 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 10sec>56C 10sec>72C 20sec)*50>72C 420sec
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0041 Publication date: 2003
PMID: 14652014 GI: 30248028 Taxonomy ID:227984
Virus Name: SARS coronavirus Tor2 Product size (PCR): 166 bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec[-1C/Cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer
Polymerase: 0.04U/microL Taq DNA polymerase (Invitrogen)Cycler: MasterCycler (Eppendorf)
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0123 Publication date: 02/04
PMID: 15030680 GI: 33578015 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 10sec>56C 10sec>72C 20sec)*50>72C 420sec
Buffer:
Polymerase: Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0041 Publication date: 2003
PMID: 14652014 GI: 30248028 Taxonomy ID:227984
Virus Name: SARS coronavirus Tor2 Product size (PCR): 166 bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: N/A
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec[-1C/Cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer
Polymerase: 0.04U/microL Taq DNA polymerase (Invitrogen)Cycler: MasterCycler (Eppendorf)
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0091 Publication date: 2003
PMID: 14522061 GI: 3796831 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): bp
MgCl2: 50 mM dNTPs: 0.200 mM Type: Nested PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C [+1C/cyc] 10sec>72C 20sec)*10>(95C 10sec> 56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer (Invirogen)
Polymerase: 2.5U Platinum Taq poly (Invitrogen)Cycler:
Note:



Oligonucleotide information
Forward(BNIoutS2) primer
Oligo ID:SG004105
Oligo type: Forward Primer Denegeracy: 1
Target: 18153-18176 Tm: 70.2C at salt 1000.0 mMLength: 24
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0123 Publication date: 02/04
PMID: 15030680 GI: 33578015 Taxonomy ID:227859
Virus Name: SARS coronavirus Product size (PCR): 195 bp
MgCl2: mM dNTPs: mM Type: RT-PCR
Temp (PCR cycle):50C 1800sec>95C 900sec>(95C 10sec>56C 10sec>72C 20sec)*50>72C 420sec
Buffer:
Polymerase: Cycler:
Note:

Total 9 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.