A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(SARS1s) primer
Oligo ID:SG004101
Oligo type: Forward Primer Denegeracy: 1
Target: 15271-15291 Tm: 74.4C at salt 1000.0 mMLength: 21
Sequence: CCTCTCTTGTTCTTGCTCGCA
(3 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: SG0041 Publication date: 2003
PMID: 14652014 GI: 30248028 Taxonomy ID:227984
Virus Name: SARS coronavirus Tor2 Product size (PCR): 100 bp
MgCl2: 5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec[-1C/Cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer
Polymerase: 0.04U/microL Taq DNA polymerase (Invitrogen)Cycler: MasterCycler (Eppendorf)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.