A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(SG001804) primer
Oligo ID:SG001804
Oligo type: Forward Primer Denegeracy: 1
Target: 7616-7641 Tm: 78.9C at salt 1000.0 mMLength: 26
Sequence: GAGCTGGACACTTACACCATGATCTC
(0 other experimental conditions)
Note: Covers 6 of the 7 serotypes.

Experimental condition used for the oligonucleotide

Common Data ID: SG0018 Publication date: 06/03
PMID: 14551821 GI: 37223495 Taxonomy ID:12110
Virus Name: Foot-and-mouth disease virus Product size (PCR): 428 bp
MgCl2: 3.5 mM dNTPs: 0.2 mM Type: Q-RT-PCR
Temp (PCR cycle):95C 120sec>(95C 15sec>60C 15sec>75C 15sec)*55
Buffer: 400mM Tricine-KOH [pH 8.0], 160mM KCl, 37.5 microG/mL BSA
Polymerase: 1x Titanium Taq poly (Clontech Laboratories)Cycler: ABI Prism 7700 (Applied Biosystems)
Note: Covers 6 of the 7 serotypes.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.